ATP5PO (NM_001697) Human 3' UTR Clone

CAT#: SC200379

3`UTR clone of ATP synthase H+ transporting mitochondrial F1 complex O subunit (ATP5O) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ATP5PO
• Synonyms: ATP5O; ATPO; HMC08D05; OSCP
• ACCN: NM_001697
• Insert Size: 86 bp
• Sequence Data:
  Insert Sequence

  >SC200379 3'UTR clone of NM_001697
  The sequence shown below is from the reference sequence of NM_001697. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGGGCTATGCGGGAGATTGTCTAAAAGTGTTGGTTTTCTGCCATCAGTGAAAATTCTTAAACTTGGAGCA
  ACAATAAAAAGCTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001697.2
• Summary: 'The protein encoded by this gene is a component of the F-type ATPase found in the mitochondrial matrix. F-type ATPases are composed of a catalytic core and a membrane proton channel. The encoded protein appears to be part of the connector linking these two components and may be involved in transmission of conformational changes or proton conductance. [provided by RefSeq, Jul 2008]'
• Locus ID: 539