RUVBL2 (NM_006666) Human 3' UTR Clone

CAT#: SC200395

3`UTR clone of RuvB-like 2 (E. coli) (RUVBL2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RUVBL2
• Synonyms: CGI-46; ECP-51; ECP51; INO80J; REPTIN; RVB2; TAP54-beta; TIH2; TIP48; TIP49B
• ACCN: NM_006666
• Insert Size: 92
• Sequence Data:
  Insert Sequence

  >SC200395 3'UTR clone of NM_006666
  The sequence shown below is from the reference sequence of NM_006666. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAACGAACTCAAAGGCGAGACCATGGACACCTCCTGAGTTGGATGTCATCCCCCGACCCCACCCTGTTTT
  CCACCAGAGTTCTGACACTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006666.1
• Summary: This gene encodes the second human homologue of the bacterial RuvB gene. Bacterial RuvB protein is a DNA helicase essential for homologous recombination and DNA double-strand break repair. Functional analysis showed that this gene product has both ATPase and DNA helicase activities. This gene is physically linked to the CGB/LHB gene cluster on chromosome 19q13.3, and is very close (55 nt) to the LHB gene, in the opposite orientation. [provided by RefSeq, Jul 2008]
• Locus ID: 10856