Tropomyosin 2 (TPM2) (NM_213674) Human 3' UTR Clone

CAT#: SC200452

3`UTR clone of tropomyosin 2 (beta) (TPM2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TPM2
• Synonyms: AMCD1; DA1; DA2B; DA2B4; HEL-S-273; NEM4; TMSB
• ACCN: NM_213674
• Insert Size: 99 bp
• Sequence Data:
  Insert Sequence

  >SC200452 3'UTR clone of NM_213674
  The sequence shown below is from the reference sequence of NM_213674. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTGGAACTCAACAACCTGTGAGGGCCAGCCCCACCCCCAGCCAGGCTATGGTTGCCACCCCAACCCAA
  TAAAACTGATGTTACTAGCCTCTCAAGGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_213674.1
• Summary: 'This gene encodes beta-tropomyosin, a member of the actin filament binding protein family, and mainly expressed in slow, type 1 muscle fibers. Mutations in this gene can alter the expression of other sarcomeric tropomyosin proteins, and cause cap disease, nemaline myopathy and distal arthrogryposis syndromes. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]'
• Locus ID: 7169