ASAH2 (NM_019893) Human 3' UTR Clone

CAT#: SC200460

3`UTR clone of N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASAH2
• Synonyms: BCDase; HNAC1; LCDase; N-CDase; NCDase
• ACCN: NM_019893
• Insert Size: 71
• Sequence Data:
  Insert Sequence

  >SC200460 3'UTR clone of NM_019893
  The sequence shown below is from the reference sequence of NM_019893. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGCTTTTGAAGTTGTAACTATTTAGTGAAAAGTTGATAGATCATTTAAAGAACAGCTTTACTCTCTACA
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_019893.2
• Summary: Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]). [supplied by OMIM, Mar 2008]
• Locus ID: 56624