ASAH2 (NM_001143974) Human 3' UTR Clone
CAT#: SC200461
3`UTR clone of N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2) transcript variant 2 for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "ASAH2"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ASAH2 |
Synonyms | BCDase; HNAC1; LCDase; N-CDase; NCDase |
ACCN | NM_001143974 |
Insert Size | 71 |
Sequence Data |
>SC200461 3'UTR clone of NM_001143974
The sequence shown below is from the reference sequence of NM_001143974. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CGGCTTTTGAAGTTGTAACTATTTAGTGAAAAGTTGATAGATCATTTAAAGAACAGCTTTACTCTCTACA C ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_001143974.1 |
Summary | Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]). [supplied by OMIM, Mar 2008] |
Locus ID | 56624 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.