AGBL5 (NM_001035507) Human 3' UTR Clone
CAT#: SC200462
3`UTR clone of ATP/GTP binding protein-like 5 (AGBL5) transcript variant 3 for miRNA target validation
Product Images
Other products for "AGBL5"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | AGBL5 |
Synonyms | CCP5; RP75 |
ACCN | NM_001035507 |
Insert Size | 83 |
Sequence Data |
>SC200462 3'UTR clone of NM_001035507
The sequence shown below is from the reference sequence of NM_001035507. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CATGTGTTCGGTTGTCTGGGGCATTGCTGGGGGAAGTAAGAGCTTGAAGATATACTGTTGGCCCAGGACC AAGGGGTGAATCA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_001035507.2 |
Summary | This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016] |
Locus ID | 60509 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.