CYP4F12 (NM_023944) Human 3' UTR Clone

CAT#: SC200467

3`UTR clone of cytochrome P450 family 4 subfamily F polypeptide 12 (CYP4F12) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CYP4F12
• Synonyms: CYPIVF12; F22329_1
• ACCN: NM_023944
• Insert Size: 91
• Sequence Data:
  Insert Sequence

  >SC200467 3'UTR clone of NM_023944
  The sequence shown below is from the reference sequence of NM_023944. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCTGAATGTAGGCTTGCAGTGACTTTCTGACCCATCCACCTGTTTTTTTGCAGATTGTCATGAATAAAA
  CGGTGCTGTCACCTCTGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_023944.2
• Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
• Locus ID: 66002