POLE2 (NM_002692) Human 3' UTR Clone

CAT#: SC200500

3`UTR clone of polymerase (DNA directed) epsilon 2 (p59 subunit) (POLE2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLE2
• Synonyms: DPE2
• ACCN: NM_002692
• Insert Size: 103
• Sequence Data:
  Insert Sequence

  >SC200500 3'UTR clone of NM_002692
  The sequence shown below is from the reference sequence of NM_002692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACAGTAGAAGATAGCAAACTTCAAGGCTTTTGAGATTCTTAAAGATCATCTGAAGAAAATTCATCAGT
  TTTCTGCTTAACTCTATATCTTATGTGATTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_002692.2
• Summary: DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
• Locus ID: 5427