ACTG2 (NM_001615) Human 3' UTR Clone
CAT#: SC200507
3`UTR clone of actin gamma 2 smooth muscle enteric (ACTG2) for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "ACTG2"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ACTG2 |
Synonyms | ACT; ACTA3; ACTE; ACTL3; ACTSG; VSCM |
ACCN | NM_001615 |
Insert Size | 75 bp |
Sequence Data |
>SC200507 3'UTR clone of NM_001615
The sequence shown below is from the reference sequence of NM_001615. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CCATTGTCCACAGGAAGTGCTTCTAAAGTCAGAACAGGTTCTCCAAGGATCCCCTCGAGACTACTCTGTT ACCAG ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_001615.3 |
Summary | 'Actins are highly conserved proteins that are involved in various types of cell motility and in the maintenance of the cytoskeleton. Three types of actins, alpha, beta and gamma, have been identified in vertebrates. Alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton and as mediators of internal cell motility. This gene encodes actin gamma 2; a smooth muscle actin found in enteric tissues. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Based on similarity to peptide cleavage of related actins, the mature protein of this gene is formed by removal of two N-terminal peptides.[provided by RefSeq, Dec 2010]' |
Locus ID | 72 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.