ABP1 (AOC1) (NM_001091) Human 3' UTR Clone

CAT#: SC200510

3`UTR clone of amiloride binding protein 1 (amine oxidase (copper-containing)) (ABP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AOC1
• Synonyms: ABP; ABP1; DAO; DAO1; KAO
• ACCN: NM_001091
• Insert Size: 94
• Sequence Data:
  Insert Sequence

  >SC200510 3'UTR clone of NM_001091
  The sequence shown below is from the reference sequence of NM_001091. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACCTATAGACCTGTGTGACCAGCCCCCAGTTCCTCCCCCAGTTCCTCCCAGGAAGCCCAGGAGCCTCA
  CTGGGGCAGACAATAAACCCTCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001091.2
• Summary: This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
• Locus ID: 26