NDUFS3 (NM_004551) Human 3' UTR Clone
CAT#: SC200525
3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 3 30kDa (NADH-coenzyme Q reductase) (NDUFS3) nuclear gene encoding mitochondrial protein for miRNA target validation
Product Images
![](https://cdn.origene.com/img/defaults-img.jpg)
Other products for "NDUFS3"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | NDUFS3 |
Synonyms | CI-30; MC1DN8 |
ACCN | NM_004551 |
Insert Size | 86 bp |
Sequence Data |
>SC200525 3'UTR clone of NM_004551
The sequence shown below is from the reference sequence of NM_004551. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC GGAGACAAGAAGCCTGATGCCAAGTAGCTCCAGGGAACGCATGTGGATCCTAGACAGCGCCTTATCTATG ATTGAGTGTCCGTGTA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. |
Reference Data | |
RefSeq | NM_004551.2 |
Summary | 'This gene encodes one of the iron-sulfur protein (IP) components of mitochondrial NADH:ubiquinone oxidoreductase (complex I). Mutations in this gene are associated with Leigh syndrome resulting from mitochondrial complex I deficiency.[provided by RefSeq, Apr 2009]' |
Locus ID | 4722 |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.