NDUFS3 (NM_004551) Human 3' UTR Clone

CAT#: SC200525

3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 3 30kDa (NADH-coenzyme Q reductase) (NDUFS3) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFS3
• Synonyms: CI-30; MC1DN8
• ACCN: NM_004551
• Insert Size: 86 bp
• Sequence Data:
  Insert Sequence

  >SC200525 3'UTR clone of NM_004551
  The sequence shown below is from the reference sequence of NM_004551. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGACAAGAAGCCTGATGCCAAGTAGCTCCAGGGAACGCATGTGGATCCTAGACAGCGCCTTATCTATG
  ATTGAGTGTCCGTGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004551.2
• Summary: 'This gene encodes one of the iron-sulfur protein (IP) components of mitochondrial NADH:ubiquinone oxidoreductase (complex I). Mutations in this gene are associated with Leigh syndrome resulting from mitochondrial complex I deficiency.[provided by RefSeq, Apr 2009]'
• Locus ID: 4722