PQBP1 (NM_001032384) Human 3' UTR Clone

CAT#: SC200541

3`UTR clone of polyglutamine binding protein 1 (PQBP1) transcript variant 5 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PQBP1
• Synonyms: MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
• ACCN: NM_001032384
• Insert Size: 74
• Sequence Data:
  Insert Sequence

  >SC200541 3'UTR clone of NM_001032384
  The sequence shown below is from the reference sequence of NM_001032384. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAACCAAGCAGCAGGATTGAAGCTTCGGCCTCCCTGGCCCTGGGTTAAAATAAAAGCTTTCTGGTGATCC
  TGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001032384.1
• Summary: This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
• Locus ID: 10084