UBC (NM_021009) Human 3' UTR Clone

CAT#: SC200562

3`UTR clone of ubiquitin C (UBC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UBC
• Synonyms: HMG20
• ACCN: NM_021009
• Insert Size: 108 bp
• Sequence Data:
  Insert Sequence

  >SC200562 3'UTR clone of NM_021009
  The sequence shown below is from the reference sequence of NM_021009. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAGTCCACTCTGCACTTGGTCCTGCGCTTGAGGGGGGGTGTCTAAGTTTCCCCTTTTAAGGTTTCAACA
  AATTTCATTGCACTTTCCTTTCAATAAAGTTGTTGCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021009.4
• Summary: 'This gene represents a ubiquitin gene, ubiquitin C. The encoded protein is a polyubiquitin precursor. Conjugation of ubiquitin monomers or polymers can lead to various effects within a cell, depending on the residues to which ubiquitin is conjugated. Ubiquitination has been associated with protein degradation, DNA repair, cell cycle regulation, kinase modification, endocytosis, and regulation of other cell signaling pathways. [provided by RefSeq, Aug 2010]'
• Locus ID: 7316