ARD1A (NAA10) (NM_003491) Human 3' UTR Clone

CAT#: SC200566

3`UTR clone of ARD1 homolog A N-acetyltransferase (S. cerevisiae) (ARD1A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NAA10
• Synonyms: ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2
• ACCN: NM_003491
• Insert Size: 109
• Sequence Data:
  Insert Sequence

  >SC200566 3'UTR clone of NM_003491
  The sequence shown below is from the reference sequence of NM_003491. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCACAGATGTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAGAGCCTGCCCCATCCCCTCCTCAC
  CCCACGAGCTTTCACAATAAATTTGCTCCGTGGCACTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003491.2
• Summary: N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
• Locus ID: 8260