TCIRG1 (NM_006019) Human 3' UTR Clone

CAT#: SC200605

3`UTR clone of T-cell immune regulator 1 ATPase H+ transporting lysosomal V0 subunit A3 (TCIRG1) transcript variant 1

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TCIRG1
• Synonyms: a3; Atp6i; ATP6N1C; ATP6V0A3; OC-116kDa; OC116; OPTB1; Stv1; TIRC7; Vph1
• ACCN: NM_006019
• Insert Size: 93
• Sequence Data:
  Insert Sequence

  >SC200605 3'UTR clone of NM_006019
  The sequence shown below is from the reference sequence of NM_006019. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCACCTTCGCTGCCACAGATGACTAGGGCCCACTGCAGGTCCTGCCAGACCTCCTTCCTGACCTCTGAG
  GCAGGAGAGGAATAAAGACGGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006019.2
• Summary: This gene encodes a subunit of a large protein complex known as a vacuolar H+-ATPase (V-ATPase). The protein complex acts as a pump to move protons across the membrane. This movement of protons helps regulate the pH of cells and their surrounding environment. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Alternative splicing results in multiple transcript variants. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, May 2017]
• Locus ID: 10312