TUBA3E (NM_207312) Human 3' UTR Clone

CAT#: SC200609

3`UTR clone of tubulin alpha 3e (TUBA3E) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TUBA3E
• Synonyms: alpha 3e; tubulin
• ACCN: NM_207312
• Insert Size: 89
• Sequence Data:
  Insert Sequence

  >SC200609 3'UTR clone of NM_207312
  The sequence shown below is from the reference sequence of NM_207312. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGGCTGAAGAAGGCGAAGAATACTGAGGGGAGGGTGTGGTGGGTTCTCCCCTGCCACCCCTAGGATGG
  CTGCTTTCAAGTTGTTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_207312.2
• Summary: Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. This gene encodes an alpha tubulin that highly conserved among species. A missense mutation in this gene has been potentially linked to microlissencephaly and global developmental delay. [provided by RefSeq, Jul 2016]
• Locus ID: 112714