SGT1 (ECD) (NM_001135752) Human 3' UTR Clone
CAT#: SC200648
3`UTR clone of ecdysoneless homolog (Drosophila) (ECD) transcript variant 2 for miRNA target validation
Product Images
Other products for "ECD"
Specifications
Product Data | |
Vector | pMirTarget |
Species | Human |
Transfection Reporter | RFP |
Assay Reporter | Luciferase |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Symbol | ECD |
Synonyms | GCR2; HSGT1; SGT1 |
ACCN | NM_001135752 |
Insert Size | 91 |
Sequence Data |
>SC200648 3'UTR clone of NM_001135752
The sequence shown below is from the reference sequence of NM_001135752. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon CAATTGGCAGAGCTCAGAATTCAAGCGATCGC CACAGACCAACAAGTAAGCCAACAAAAAATTAACCAGCACATTTAGCTTCTCTTTTTTCTTTTTAAATAA ATATTGAATATGATTCTGTTC ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG |
Restriction Sites | SgfI-MluI |
OTI Disclaimer | Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). |
Reference Data | |
RefSeq | NM_001135752.1 |
Locus ID | 11319 |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.