SGT1 (ECD) (NM_007265) Human 3' UTR Clone

CAT#: SC200649

3`UTR clone of ecdysoneless homolog (Drosophila) (ECD) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ECD
• Synonyms: GCR2; HSGT1; SGT1
• ACCN: NM_007265
• Insert Size: 91
• Sequence Data:
  Insert Sequence

  >SC200649 3'UTR clone of NM_007265
  The sequence shown below is from the reference sequence of NM_007265. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACAGACCAACAAGTAAGCCAACAAAAAATTAACCAGCACATTTAGCTTCTCTTTTTTCTTTTTAAATAA
  ATATTGAATATGATTCTGTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_007265.2
• Locus ID: 11319