HBZ (NM_005332) Human 3' UTR Clone

CAT#: SC200674

3`UTR clone of hemoglobin zeta (HBZ) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HBZ
• Synonyms: HBAZ; HBZ-T1; HBZ1
• ACCN: NM_005332
• Insert Size: 130 bp
• Sequence Data:
  Insert Sequence

  >SC200674 3'UTR clone of NM_005332
  The sequence shown below is from the reference sequence of NM_005332. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCGGTCGTATCCTCTGTCCTGACCGAGAAGTACCGCTGAGCGCCGCCTCCGGGACCCCCAGGACAGGCT
  GCGGCCCCTCCCCCGTCCTGGAGGTTCCCCAGCCCCACTTACCGCGTAATGCGCCAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005332.2
• Summary: 'Zeta-globin is an alpha-like hemoglobin. The zeta-globin polypeptide is synthesized in the yolk sac of the early embryo, while alpha-globin is produced throughout fetal and adult life. The zeta-globin gene is a member of the human alpha-globin gene cluster that includes five functional genes and two pseudogenes. The order of genes is: 5' - zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 -alpha-1 - theta1 - 3'. [provided by RefSeq, Nov 2009]'
• Locus ID: 3050