LIPT1 (NM_145197) Human 3' UTR Clone

CAT#: SC200760

3`UTR clone of lipoyltransferase 1 (LIPT1) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "LIPT1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol LIPT1
Synonyms LIPT1D
ACCN NM_145197
Insert Size 97
Sequence Data
>SC200760 3'UTR clone of NM_145197
The sequence shown below is from the reference sequence of NM_145197. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTCTCTGTGAAAAAATTAAGGGAATAATGTGATTCCAAGTAAATGTCTTAATACAGTTTCAATTAGAAAA
TAAAATGTCTCATACTTGCACATTGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_145197.2
Summary The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read-through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, Mar 2011]
Locus ID 51601

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.