LIPT1 (NM_145198) Human 3' UTR Clone

CAT#: SC200761

3`UTR clone of lipoyltransferase 1 (LIPT1) nuclear gene encoding mitochondrial protein transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LIPT1
• Synonyms: LIPT1D
• ACCN: NM_145198
• Insert Size: 97
• Sequence Data:
  Insert Sequence

  >SC200761 3'UTR clone of NM_145198
  The sequence shown below is from the reference sequence of NM_145198. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCTCTGTGAAAAAATTAAGGGAATAATGTGATTCCAAGTAAATGTCTTAATACAGTTTCAATTAGAAAA
  TAAAATGTCTCATACTTGCACATTGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_145198.2
• Summary: The process of transferring lipoic acid to proteins is a two-step process. The first step is the activation of lipoic acid by lipoate-activating enzyme to form lipoyl-AMP. For the second step, the protein encoded by this gene transfers the lipoyl moiety to apoproteins. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 13. Read-through transcription also exists between this gene and the neighboring downstream mitochondrial ribosomal protein L30 (MRPL30) gene. [provided by RefSeq, Mar 2011]
• Locus ID: 51601