Caspase 5 (CASP5) (NM_004347) Human 3' UTR Clone

CAT#: SC200804

3`UTR clone of caspase 5 apoptosis-related cysteine peptidase (CASP5) transcript variant a for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CASP5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CASP5
Synonyms ICE(rel)III; ICEREL-III; ICH-3
ACCN NM_004347
Insert Size 151 bp
Sequence Data
>SC200804 3'UTR clone of NM_004347
The sequence shown below is from the reference sequence of NM_004347. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGAGCAACCTTGACAAGAGATTTCTACCTCTTTCCTGGCAATTGAAAATGAAACCACAGGCAGCCCAGCC
CTCCTCTGTCAACATCAAAGAGCACATTTACCAGTATAGCTTGCATAGTCAATATTTGGTATTTCAATAA
AAGTAAAGACT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004347.3
Summary 'This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. Overexpression of the active form of this enzyme induces apoptosis in fibroblasts. Max, a central component of the Myc/Max/Mad transcription regulation network important for cell growth, differentiation, and apoptosis, is cleaved by this protein; this process requires Fas-mediated dephosphorylation of Max. The expression of this gene is regulated by interferon-gamma and lipopolysaccharide. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Aug 2010]'
Locus ID 838

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.