Caspase 4 (CASP4) (NM_001225) Human 3' UTR Clone

CAT#: SC200807

3`UTR clone of caspase 4 apoptosis-related cysteine peptidase (CASP4) transcript variant alpha for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP4
• Synonyms: ICE(rel)II; ICEREL-II; ICH-2; Mih1; Mih1/TX; TX
• ACCN: NM_001225
• Insert Size: 135 bp
• Sequence Data:
  Insert Sequence

  >SC200807 3'UTR clone of NM_001225
  The sequence shown below is from the reference sequence of NM_001225. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTCTACCTCTTTCCTGGCAATTGAAAATGGAAGCCACAAGCAGCCCAGCCCTCCTTAATCAACTTCAAGG
  AGCACCTTCATTAGTACAGCTTGCATATTTAACATTTTGTATTTCAATAAAAGTGAAGACAAACG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001225.3
• Summary: 'This gene encodes a protein that is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain and a large and small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This caspase is able to cleave and activate its own precursor protein, as well as caspase 1 precursor. When overexpressed, this gene induces cell apoptosis. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]'
• Locus ID: 837