DNA polymerase delta p50 (POLD2) (NM_001127218) Human 3' UTR Clone

CAT#: SC200815

3`UTR clone of polymerase (DNA directed) delta 2 regulatory subunit 50kDa (POLD2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLD2
• Synonyms: OTTHUMP00000024527; polymerase (DNA directed), delta 2, regulatory subunit; polymerase (DNA directed), delta 2, regulatory subunit (50kD); polymerase (DNA directed), delta 2, regulatory subunit 50kDa
• ACCN: NM_001127218
• Insert Size: 136 bp
• Sequence Data:
  Insert Sequence

  >SC200815 3'UTR clone of NM_001127218
  The sequence shown below is from the reference sequence of NM_001127218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGCAGAGGACGATGACCTGGGAGGCCTGGGGCTGGGCCCCTGACTCAAAAAAGTGGTTTTGACCAGAGAG
  GCCCAGATGGAGGCTGTTCATTCCCTGCAGTGTCGGCATTGTAAATAAAGCCTGAGCACTTGCTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001127218.1
• Summary: 'This gene encodes the 50-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. The encoded protein is required for the stimulation of DNA polymerase delta activity by the processivity cofactor proliferating cell nuclear antigen (PCNA). Expression of this gene may be a marker for ovarian carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Mar 2012]'
• Locus ID: 5425