RPS9 (NM_001013) Human 3' UTR Clone

CAT#: SC200819

3`UTR clone of ribosomal protein S9 (RPS9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPS9
• Synonyms: S9
• ACCN: NM_001013
• Insert Size: 73 bp
• Sequence Data:
  Insert Sequence

  >SC200819 3'UTR clone of NM_001013
  The sequence shown below is from the reference sequence of NM_001013. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGGAGACGACGAGGAGGAGGATTAAGTCCACCTGTCCCTCCTGGGCTGCTGGATTGTCTCGTTTTCCT
  GCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001013.3
• Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S4P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, multiple processed pseudogenes derived from this gene are dispersed through the genome. [provided by RefSeq, Jul 2008]'
• Locus ID: 6203