PSMD6 (NM_014814) Human 3' UTR Clone

CAT#: SC200832

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 6 (PSMD6) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMD6
• Synonyms: p42A; p44S10; Rpn7; S10; SGA-113M
• ACCN: NM_014814
• Insert Size: 121
• Sequence Data:
  Insert Sequence

  >SC200832 3'UTR clone of NM_014814
  The sequence shown below is from the reference sequence of NM_014814. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGAGTTCAAAAACTTTCCAGAGTAATTAATATGTAAAGCCATGTAACTAACAAAGGATTTGCTTTAGAG
  ATAATTATTTGGAATTTTTATAGCTTACTTCACAATGTGCCCAGGTCAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014814.1
• Summary: This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
• Locus ID: 9861