PSMD6 (NM_014814) Human 3' UTR Clone

CAT#: SC200832

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 6 (PSMD6) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "PSMD6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PSMD6
Synonyms p42A; p44S10; Rpn7; S10; SGA-113M
ACCN NM_014814
Insert Size 121
Sequence Data
>SC200832 3'UTR clone of NM_014814
The sequence shown below is from the reference sequence of NM_014814. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGAGTTCAAAAACTTTCCAGAGTAATTAATATGTAAAGCCATGTAACTAACAAAGGATTTGCTTTAGAG
ATAATTATTTGGAATTTTTATAGCTTACTTCACAATGTGCCCAGGTCAGCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014814.1
Summary This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Locus ID 9861

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.