NDUFS7 (NM_024407) Human 3' UTR Clone

CAT#: SC200840

3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 7 20kDa (NADH-coenzyme Q reductase) (NDUFS7) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFS7
• Synonyms: CI-20; CI-20KD; MC1DN3; MY017; PSST
• ACCN: NM_024407
• Insert Size: 90
• Sequence Data:
  Insert Sequence

  >SC200840 3'UTR clone of NM_024407
  The sequence shown below is from the reference sequence of NM_024407. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATCTGGTACCGCAGGTAGCGCCGCCGCCGCCGCCGCCGGAGCCTGTCGCCGTCCTGTCCCCAGCCTGCT
  TGTGTCCCGTGAGGTTGTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_024407.4
• Summary: This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
• Locus ID: 374291