AKR1A1 (NM_006066) Human 3' UTR Clone

CAT#: SC200844

3`UTR clone of aldo-keto reductase family 1 member A1 (aldehyde reductase) (AKR1A1) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "AKR1A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AKR1A1
Synonyms ALDR1; ALR; ARM; DD3; HEL-S-6
ACCN NM_006066
Insert Size 106
Sequence Data
>SC200844 3'UTR clone of NM_006066
The sequence shown below is from the reference sequence of NM_006066. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGCAGGGCATCCTCTGTACCCCTTTAATGACCCGTACTGAGACCACAGCTTCTTGGCCTCCCTTCCAGCT
CTGCAGCTAATGAGGTCCTGCCACAACGGAAAGAGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006066.2
Summary This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member, also known as aldehyde reductase, is involved in the reduction of biogenic and xenobiotic aldehydes and is present in virtually every tissue. Multiple alternatively spliced transcript variants of this gene exist, all encoding the same protein. [provided by RefSeq, Jan 2011]
Locus ID 10327

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.