DEPDC5 (NM_001136029) Human 3' UTR Clone

CAT#: SC200871

3`UTR clone of DEP domain containing 5 (DEPDC5) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DEPDC5
• Synonyms: DEP.5; FFEVF; FFEVF1
• ACCN: NM_001136029
• Insert Size: 148
• Sequence Data:
  Insert Sequence

  >SC200871 3'UTR clone of NM_001136029
  The sequence shown below is from the reference sequence of NM_001136029. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTTCTGGACAAGTTGCCTGGAGAAGATGCATGCCAGTGCCCCGTGAGGCCAGGCTGCACCTGTGCTGGGG
  GAAGGTGGGTGAGCCACTGCCCTCAAACCCGGGGCGGAGGATTCCAGGCAGGCTCTAGGAGTCAGGTGTC
  CGTTTGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001136029.1
• Summary: This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
• Locus ID: 9681