PHF10 (NM_133325) Human 3' UTR Clone

CAT#: SC200874

3`UTR clone of PHD finger protein 10 (PHF10) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PHF10
• Synonyms: BAF45A; XAP135
• ACCN: NM_133325
• Insert Size: 119
• Sequence Data:
  Insert Sequence

  >SC200874 3'UTR clone of NM_133325
  The sequence shown below is from the reference sequence of NM_133325. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGGAAAGTGGGCAGAAGGGGGAAAAACAGCAAAGAGGGATAAAATAGTTTTTGACTCTAATACTGTAT
  ATGCATTTAAGTGGAATATTTGGTGCCATTTACAACATTATTTTCATGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_133325.2
• Summary: This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
• Locus ID: 55274