Defensin alpha 3 (DEFA3) (NM_005217) Human 3' UTR Clone

CAT#: SC200884

3`UTR clone of defensin alpha 3 neutrophil-specific (DEFA3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DEFA3
• Synonyms: DEF3; HNP-3; HNP3; HP-3; HP3
• ACCN: NM_005217
• Insert Size: 151 bp
• Sequence Data:
  Insert Sequence

  >SC200884 3'UTR clone of NM_005217
  The sequence shown below is from the reference sequence of NM_005217. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCATCTACCAGGGAAGACTCTGGGCATTCTGCTGCTGAGCTTGCAGAAAAAGAAAAATGAGCTCAAAATT
  TGCTTTGAGAGCTACAGGGAATTGCTATTACTCCTGTACCTTCTGCTCAATTTCCTTTCCTCATCTCAAA
  TAAATGCCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005217.2
• Summary: 'Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 3, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 1 by only one amino acid. This gene and the gene encoding defensin, alpha 1 are both subject to copy number variation. [provided by RefSeq, Oct 2014]'
• Locus ID: 1668