ATP5MC1 (NM_001002027) Human 3' UTR Clone

CAT#: SC200892

3`UTR clone of ATP synthase H+ transporting mitochondrial F0 complex subunit C1 (subunit 9) (ATP5G1) nuclear gene encoding mitochondrial protein transcript variant 2

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP5MC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP5MC1
Synonyms ATP5A; ATP5G; ATP5G1
ACCN NM_001002027
Insert Size 127 bp
Sequence Data
>SC200892 3'UTR clone of NM_001002027
The sequence shown below is from the reference sequence of NM_001002027. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGTCACCGGCCTGTTGCTACTG
CAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTTACCATTAAACACAACG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001002027.1
Summary 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 516

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.