FASTK (NM_033015) Human 3' UTR Clone

CAT#: SC200894

3`UTR clone of Fas-activated serine/threonine kinase (FASTK) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FASTK
• Synonyms: FAST
• ACCN: NM_033015
• Insert Size: 129
• Sequence Data:
  Insert Sequence

  >SC200894 3'UTR clone of NM_033015
  The sequence shown below is from the reference sequence of NM_033015. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGCTCCAGGCCCTGGGCCTGCGCTGGGGGCCTGAAGGGGGCTGAGGGGTTGATGTGGGGTTCAGGAT
  GGCCCCCCCATGGGGGGTGGATGATTTGCACTTTGGTTCCCTGTGTTTTGATTTCTCAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033015.2
• Summary: The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be activated rapidly during Fas-mediated apoptosis in Jurkat cells. In response to Fas receptor ligation, it phosphorylates TIA1, an apoptosis-promoting nuclear RNA-binding protein. The encoded protein is a strong inducer of lymphocyte apoptosis. Two transcript variants encoding different isoforms have been found for this gene. Other variants exist, but their full-length natures have not yet been determined. [provided by RefSeq, Jul 2008]
• Locus ID: 10922