Apolipoprotein H (APOH) (NM_000042) Human 3' UTR Clone

CAT#: SC200902

3`UTR clone of apolipoprotein H (beta-2-glycoprotein I) (APOH) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APOH
• Synonyms: B2G1; B2GP1; BG
• ACCN: NM_000042
• Insert Size: 122 bp
• Sequence Data:
  Insert Sequence

  >SC200902 3'UTR clone of NM_000042
  The sequence shown below is from the reference sequence of NM_000042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCCGATGTAAAGCCATGCTAAGGTGGTTTTCAGATTCCACACAAAATGTCACACTTGTTTCTTGTTCA
  TCCAAGGAACCTAATTGAAATTTAAAAATAAAGCTACTGAATTTATTGCCGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000042.2
• Summary: 'Apolipoprotein H, also known as beta-2-glycoprotein I, is a component of circulating plasma lipoproteins. It has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, hemostasis, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome (APS). The anti-beta (2) glycoprotein I antibodies from APS patients, mediate inhibition of activated protein C which has anticoagulant properties. Because beta-2-GPI is the main autoantigen in patients with APS, the disruption of this pathway by autoantibodies may be an important mechanism for thrombosis in patients with APS.[provided by RefSeq, Dec 2019]'
• Locus ID: 350