Nuclear Matrix Protein p84 (THOC1) (NM_005131) Human 3' UTR Clone

CAT#: SC200905

3`UTR clone of THO complex 1 (THOC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: THOC1
• Synonyms: HPR1; P84; P84N5
• ACCN: NM_005131
• Insert Size: 127
• Sequence Data:
  Insert Sequence

  >SC200905 3'UTR clone of NM_005131
  The sequence shown below is from the reference sequence of NM_005131. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGACCTTGCAGAAAGTCTAACTAATGACAATGAGACAAATAGTTAGCTTCTTTTTTTTTTCTTTTTATTA
  AAACTGTGATAGATTTTGTTACCAAGCAGCATTTGATAAGAGGTCCACTGGTTTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005131.2
• Summary: HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560). [supplied by OMIM, Nov 2010]
• Locus ID: 9984