Nuclear Matrix Protein p84 (THOC1) (NM_005131) Human 3' UTR Clone

CAT#: SC200905

3`UTR clone of THO complex 1 (THOC1) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "THOC1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol THOC1
Synonyms HPR1; P84; P84N5
ACCN NM_005131
Insert Size 127
Sequence Data
>SC200905 3'UTR clone of NM_005131
The sequence shown below is from the reference sequence of NM_005131. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGACCTTGCAGAAAGTCTAACTAATGACAATGAGACAAATAGTTAGCTTCTTTTTTTTTTCTTTTTATTA
AAACTGTGATAGATTTTGTTACCAAGCAGCATTTGATAAGAGGTCCACTGGTTTTGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005131.2
Summary HPR1 is part of the TREX (transcription/export) complex, which includes TEX1 (MIM 606929), THO2 (MIM 300395), ALY (MIM 604171), and UAP56 (MIM 142560). [supplied by OMIM, Nov 2010]
Locus ID 9984

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.