NDUFS4 (NM_002495) Human 3' UTR Clone

CAT#: SC200918

3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 4 18kDa (NADH-coenzyme Q reductase) (NDUFS4) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFS4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NDUFS4
Synonyms AQDQ; CI-18; CI-18 kDa; CI-AQDQ; MC1DN1
ACCN NM_002495
Insert Size 131 bp
Sequence Data
>SC200918 3'UTR clone of NM_002495
The sequence shown below is from the reference sequence of NM_002495. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACAAGAGTATCCACAAAATAGGTTGGCACTGACTATATCTCTGCTTGACTGTGAATAAAGTCAGCTGTGC
AGTATTTATAGTCCATGTATAATAAATACATCTCTTAATCTCCTAATAAATTGGACCTTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002495.2
Summary 'This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]'
Locus ID 4724

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.