NDUFS4 (NM_002495) Human 3' UTR Clone

CAT#: SC200918

3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 4 18kDa (NADH-coenzyme Q reductase) (NDUFS4) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFS4
• Synonyms: AQDQ; CI-18; CI-18 kDa; CI-AQDQ; MC1DN1
• ACCN: NM_002495
• Insert Size: 131 bp
• Sequence Data:
  Insert Sequence

  >SC200918 3'UTR clone of NM_002495
  The sequence shown below is from the reference sequence of NM_002495. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAAGAGTATCCACAAAATAGGTTGGCACTGACTATATCTCTGCTTGACTGTGAATAAAGTCAGCTGTGC
  AGTATTTATAGTCCATGTATAATAAATACATCTCTTAATCTCCTAATAAATTGGACCTTTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002495.2
• Summary: 'This gene encodes an nuclear-encoded accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (complex I, or NADH:ubiquinone oxidoreductase). Complex I removes electrons from NADH and passes them to the electron acceptor ubiquinone. Mutations in this gene can cause mitochondrial complex I deficiencies such as Leigh syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]'
• Locus ID: 4724