SNRPB (NM_198216) Human 3' UTR Clone

CAT#: SC200935

3`UTR clone of small nuclear ribonucleoprotein polypeptides B and B1 (SNRPB) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SNRPB"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SNRPB
Synonyms CCMS; COD; Sm-B/B'; SmB/B'; SmB/SmB'; snRNP-B; SNRPB1
ACCN NM_198216
Insert Size 117 bp
Sequence Data
>SC200935 3'UTR clone of NM_198216
The sequence shown below is from the reference sequence of NM_198216. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAATGCGCCCACCAAGGCCCTAGACTCATCTTGGCCCTCCTCAGCTCCCTGCCTGTTTCCCGTAAGGCT
GTACATAGTCCTTTTATCTCCTTGTGGCCTATGAAACTGGTTTATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_198216.1
Summary 'The protein encoded by this gene is one of several nuclear proteins that are found in common among U1, U2, U4/U6, and U5 small ribonucleoprotein particles (snRNPs). These snRNPs are involved in pre-mRNA splicing, and the encoded protein may also play a role in pre-mRNA splicing or snRNP structure. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding different isoforms (B and B') have been found for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 6628

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.