NAPSIN A (NAPSA) (NM_004851) Human 3' UTR Clone

CAT#: SC200951

3`UTR clone of napsin A aspartic peptidase (NAPSA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NAPSA
• Synonyms: KAP; Kdap; NAP1; NAPA; SNAPA
• ACCN: NM_004851
• Insert Size: 99
• Sequence Data:
  Insert Sequence

  >SC200951 3'UTR clone of NM_004851
  The sequence shown below is from the reference sequence of NM_004851. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTCGGATGGGGAGAGACTGCGCAGGCGCAGTTCCCCGGGTGACGCCCAAGTGAAGCGCATGCGCAGCG
  GGTGGTCGCGGAGGTCCTGCTACCCAGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004851.1
• Summary: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
• Locus ID: 9476