Apolipoprotein CI (APOC1) (NM_001645) Human 3' UTR Clone

CAT#: SC200953

3`UTR clone of apolipoprotein C-I (APOC1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APOC1
• Synonyms: Apo-CI; apo-CIB; ApoC-I; apoC-IB
• ACCN: NM_001645
• Insert Size: 157 bp
• Sequence Data:
  Insert Sequence

  >SC200953 3'UTR clone of NM_001645
  The sequence shown below is from the reference sequence of NM_001645. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGACATTTCAGAAAGTGAAGGAGAAACTCAAGATTGACTCATGAGGACCTGAAGGGTGACATCCCAGGA
  GGGGCCTCTGAAATTTCCCACACCCCAGCGCCTGTGCTGAGGACTCCCTCCATGTGGCCCCAGGTGCCAC
  CAATAAAAATCCTACAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001645.3
• Summary: 'This gene encodes a member of the apolipoprotein C1 family. This gene is expressed primarily in the liver, and it is activated when monocytes differentiate into macrophages. The encoded protein plays a central role in high density lipoprotein (HDL) and very low density lipoprotein (VLDL) metabolism. This protein has also been shown to inhibit cholesteryl ester transfer protein in plasma. A pseudogene of this gene is located 4 kb downstream in the same orientation, on the same chromosome. This gene is mapped to chromosome 19, where it resides within a apolipoprotein gene cluster. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Sep 2016]'
• Locus ID: 341