Myosin Heavy chain 1 (MYH1) (NM_005963) Human 3' UTR Clone

CAT#: SC200985

3`UTR clone of myosin heavy chain 1 skeletal muscle adult (MYH1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MYH1
• Synonyms: HEL71; MYHa; MyHC-2x; MyHC-2X/D; MYHSA1
• ACCN: NM_005963
• Insert Size: 123 bp
• Sequence Data:
  Insert Sequence

  >SC200985 3'UTR clone of NM_005963
  The sequence shown below is from the reference sequence of NM_005963. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGAAGAGCAGGGAGGTTCACACAAAAATCATAAGTGAAGAGTAATTTATCTAACTGCTGAAAGGTGACC
  AAAGAAATGCACAAAATGTGAAAATCTTTGTCACTCCATTTTGTACTTATGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005963.3
• Summary: 'Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]'
• Locus ID: 4619