GRK4 (NM_001004057) Human 3' UTR Clone

CAT#: SC201050

3`UTR clone of G protein-coupled receptor kinase 4 (GRK4) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRK4
• Synonyms: GPRK2L; GPRK4; GRK4a; IT11
• ACCN: NM_001004057
• Insert Size: 140 bp
• Sequence Data:
  Insert Sequence

  >SC201050 3'UTR clone of NM_001004057
  The sequence shown below is from the reference sequence of NM_001004057. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAACCCAAGCAATGCTGAGCACCCCGGTGCGGACCACAGAGCAGACCCTGGCGCCAGGAAGGAGCATG
  TGTTAGCGTCTCGTCCCACCTGGAATTGTAATAAATACATCTAAATAAAACATGCCTTGGGAGTGTACAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001004057.1
• Summary: 'This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]'
• Locus ID: 2868