Acid Phosphatase 2 (ACP2) (NM_001131064) Human 3' UTR Clone

CAT#: SC201066

3`UTR clone of acid phosphatase 2 lysosomal (ACP2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACP2
• Synonyms: acid phosphatase 2, lysosomal; Acp-2; LAP; OTTMUSP00000015308
• ACCN: NM_001131064
• Insert Size: 165
• Sequence Data:
  Insert Sequence

  >SC201066 3'UTR clone of NM_001131064
  The sequence shown below is from the reference sequence of NM_001131064. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCACTGAGGACAGGGTAAGAGTGGCCAGCCCTTCCCTGGGGTGGTGAGGGGACAGCTCTGGCCGTAGGCC
  TGCTGATGCCAGGCTCCTTTTCCCGCTGCCTGTTTCCCCGCTTCGCTCTACAGCTGCTGAAGTTCCCGTT
  GGGCCCATGTCCCCGTTATGAGCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001131064.1
• Summary: The protein encoded by this gene belongs to the histidine acid phosphatase family, which hydrolyze orthophosphoric monoesters to alcohol and phosphate. This protein is localized to the lysosomal membrane, and is chemically and genetically distinct from the red cell acid phosphatase. Mice lacking this gene showed multiple defects, including bone structure alterations, lysosomal storage defects, and an increased tendency towards seizures. An enzymatically-inactive allele of this gene in mice showed severe growth retardation, hair-follicle abnormalities, and an ataxia-like phenotype. Alternatively spliced transcript variants have been found for this gene. A C-terminally extended isoform is also predicted to be produced by the use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2017]
• Locus ID: 53