CARS2 (NM_024537) Human 3' UTR Clone

CAT#: SC201069

3`UTR clone of cysteinyl-tRNA synthetase 2 mitochondrial (putative) (CARS2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CARS2
• Synonyms: COXPD27; cysRS
• ACCN: NM_024537
• Insert Size: 173
• Sequence Data:
  Insert Sequence

  >SC201069 3'UTR clone of NM_024537
  The sequence shown below is from the reference sequence of NM_024537. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAACTGCTGGATCAAAGGACAAAAGACCAAAAATCAGCGGGCTGAGGATGGAGCACAGCCATGAACCTG
  CTCACGACAAGACGCACCCATGCTTCTCAGGGTCAAGGCTTTATGTTAAAGCTTCCTGTCGGGGCTGCTA
  GGTCAGCATTAAAGTAAGGCAACCAACAGTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_024537.2
• Summary: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2017]
• Locus ID: 79587