CRIP1 (NM_001311) Human 3' UTR Clone

CAT#: SC201104

3`UTR clone of cysteine-rich protein 1 (intestinal) (CRIP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CRIP1
• Synonyms: CRHP; CRIP; CRP-1; CRP1
• ACCN: NM_001311
• Insert Size: 153 bp
• Sequence Data:
  Insert Sequence

  >SC201104 3'UTR clone of NM_001311
  The sequence shown below is from the reference sequence of NM_001311. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGCCGAGAGCCACACTTTCAAGTAAACCAGGTGGTGGAGACCCCATCCTTGGCTGCTTGCAGGGCCACTG
  TCCAGGCAAATGCCAGGCCTTGTCCCCAGATGCCCAGGGCTCCCTTGTTGCCCCTAATGCTCTCAGTAAA
  CCTGAACACTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001311.4
• Summary: 'Cysteine-rich intestinal protein (CRIP) belongs to the LIM/double zinc finger protein family, members of which include cysteine- and glycine-rich protein-1 (CSRP1; MIM 123876), rhombotin-1 (RBTN1; MIM 186921), rhombotin-2 (RBTN2; MIM 180385), and rhombotin-3 (RBTN3; MIM 180386). CRIP may be involved in intestinal zinc transport (Hempe and Cousins, 1991 [PubMed 1946385]).[supplied by OMIM, Mar 2008]'
• Locus ID: 1396