Caspase 1 (CASP1) (NM_033292) Human 3' UTR Clone

CAT#: SC201112

3`UTR clone of caspase 1 apoptosis-related cysteine peptidase (interleukin 1 beta convertase) (CASP1) transcript variant alpha for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP1
• Synonyms: ICE; IL1BC; P45
• ACCN: NM_033292
• Insert Size: 119 bp
• Sequence Data:
  Insert Sequence

  >SC201112 3'UTR clone of NM_033292
  The sequence shown below is from the reference sequence of NM_033292. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACCTCTTCCCAGGACATTAAAATAAGGAAACTGTATGAATGTCTGTGGGCAGGAAGTGAAGAGATCCT
  TCTGTAAAGGTTTTTGGAATTATGTCTGCTGAATAATAAACTTTTTTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033292.2
• Summary: 'This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]'
• Locus ID: 834