ADCY8 (NM_001115) Human 3' UTR Clone

CAT#: SC201134

3`UTR clone of adenylate cyclase 8 (brain) (ADCY8) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ADCY8
• Synonyms: AC8; ADCY3; HBAC1
• ACCN: NM_001115
• Insert Size: 111
• Sequence Data:
  Insert Sequence

  >SC201134 3'UTR clone of NM_001115
  The sequence shown below is from the reference sequence of NM_001115. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGAAGGCACCGACAAATCTGATTTGCCATAAAAGCATTTTCTTTCTGTTTTTTTTTTTTGTATTTCTT
  TTATATATAAAATAAATATACTAATAAAAAGGTTTAATTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001115.2
• Summary: Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
• Locus ID: 114