AUTS2 (NM_001127232) Human 3' UTR Clone

CAT#: SC201151

3`UTR clone of autism susceptibility candidate 2 (AUTS2) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AUTS2
• Synonyms: FBRSL2; MRD26
• ACCN: NM_001127232
• Insert Size: 117
• Sequence Data:
  Insert Sequence

  >SC201151 3'UTR clone of NM_001127232
  The sequence shown below is from the reference sequence of NM_001127232. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTCGTCAAATTGCTTAAAGGATTCTAGTTCCGTTTGGTGTGGTCACTCACATTTGAATTCTAATACTCT
  ATGTGATATAGATTCTGTTGACTACTGTTAGCGTGACCCCAATGAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001127232.1
• Summary: This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]
• Locus ID: 26053