CATSPER2 (NM_054020) Human 3' UTR Clone

CAT#: SC201236

3`UTR clone of cation channel sperm associated 2 (CATSPER2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CATSPER2
• Synonyms: MGC33346
• ACCN: NM_054020
• Insert Size: 137
• Sequence Data:
  Insert Sequence

  >SC201236 3'UTR clone of NM_054020
  The sequence shown below is from the reference sequence of NM_054020. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGGCACTGATGAACTTGGAAGACAAGTAAAGCAATGGATGGCTTCAATATCCTTGGGCCCAGCAAAAGA
  TAATGAAGGGAATTGTTGGAAATAGAGAATTGAAAATATAAACATTCAGATAGAACAATGTCTGTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_054020.2
• Summary: This gene encodes a member of a family of cation channel proteins that localize to the flagellum of spermatozoa. Defects at this locus causes male infertility. Alternatively spliced transcript variants have been observed at this locus. Readthrough transcription originates upstream of this locus in diphosphoinositol pentakisphosphate kinase 1 pseudogene 1 and is represented by GeneID:110006325. Related pseudogenes are found next to this locus on chromosome 15 and on chromosome 5. [provided by RefSeq, Mar 2017]
• Locus ID: 117155