CATSPER2 (NM_172095) Human 3' UTR Clone

CAT#: SC201237

3`UTR clone of cation channel sperm associated 2 (CATSPER2) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "CATSPER2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol CATSPER2
Synonyms MGC33346
ACCN NM_172095
Insert Size 137
Sequence Data
>SC201237 3'UTR clone of NM_172095
The sequence shown below is from the reference sequence of NM_172095. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGGCACTGATGAACTTGGAAGACAAGTAAAGCAATGGATGGCTTCAATATCCTTGGGCCCAGCAAAAGA
TAATGAAGGGAATTGTTGGAAATAGAGAATTGAAAATATAAACATTCAGATAGAACAATGTCTGTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172095.1
Summary This gene encodes a member of a family of cation channel proteins that localize to the flagellum of spermatozoa. Defects at this locus causes male infertility. Alternatively spliced transcript variants have been observed at this locus. Readthrough transcription originates upstream of this locus in diphosphoinositol pentakisphosphate kinase 1 pseudogene 1 and is represented by GeneID:110006325. Related pseudogenes are found next to this locus on chromosome 15 and on chromosome 5. [provided by RefSeq, Mar 2017]
Locus ID 117155

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.