GALT (NM_000155) Human 3' UTR Clone

CAT#: SC201242

3`UTR clone of galactose-1-phosphate uridylyltransferase (GALT) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GALT"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GALT
ACCN NM_000155
Insert Size 119 bp
Sequence Data
>SC201242 3'UTR clone of NM_000155
The sequence shown below is from the reference sequence of NM_000155. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGACAGCAACCATCGCCTGACCACGCCGACCACAGGGCCTTGAATCCTTTTTTGTTTTCAACAGTCTTGC
TGAATTAAGCAGAAAGGGCCTTGAATCCTGGCCTGGAATTTGGGCAGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000155.2
Summary 'Galactose-1-phosphate uridyl transferase (GALT) catalyzes the second step of the Leloir pathway of galactose metabolism, namely the conversion of UDP-glucose + galactose-1-phosphate to glucose-1-phosphate + UDP-galactose. The absence of this enzyme results in classic galactosemia in humans and can be fatal in the newborn period if lactose is not removed from the diet. The pathophysiology of galactosemia has not been clearly defined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]'
Locus ID 2592

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.